Ekspresja informacji genetycznej

Brak komentarzy

Ekspresja genu to proces w którym informacja genetyczna jest odczytywana i przepisywana na jej produkt – białko. Pierwszymi etapami są transkrypcja, czyli synteza mRNA na matrycy DNA i translacja – synteza polipeptydu na matrycy mRNA.

zrzut ekranu 2019-01-6 o 17.42.20

Podczas rozwiązywanie zadań dotyczących tego procesu należy zwrócić szczególną uwagę na kierunek zachodzenia poszczególnych procesów.

Pierwsze co należy zrobić rozwiązując tego typu zadanie to sprawdzić, którą nić mamy podaną – jeśli jest to nić 3′-5′ (kodującą) możemy przejść dalej, jeśli 5′-3′ (niekodującą) należy ją przepisać na komplementarną 3′-5′.

Dlaczego? Kolejność ma znaczenie – ten sam kodon doczytany od tyłu może kodować zupełnie inny aminokwas! Biorąc do transkrypcji niewłaściwą nić otrzymamy zupełnie inne białko.

Mając nić 3′-5′ przechodzimy do transkrypcji: polimeraza RNA przesuwa się w kierunku od 3′-5′, więc nowa nić jest syntezowana od 5′ do 3′.

Nowo zsyntezowana nić mRNA powstała od 5 ‚do 3′, znajdują się na niej kodony do których podczas translacji przyłączają się antykodony z tRNA.

Translacja zachodzi od końca 5′ do 3’ i w taki sposób należy odczytywać kodony, które umożliwiają nam sprawdzenie aminokwasów tworzących polipeptyd.

Przykład:

Zrzut ekranu 2019-01-6 o 16.59.12.png

Podaj nazwę czwartego aminokwasu w sekwencji prawidłowego polipeptydu oraz nazwęczwartego aminokwasu w polipeptydzie 1. Przyjmij założenie, że w ich skład nie wchodzi aminokwas kodowany przez kodon START.

Podana sekwencja:

5’ ATGGCCCTGTGGATGCGCCTCCTGCCCCTGCTGGCG… 3’.

Jest to nić 5′-3′ czyli niekodująca, po pierwsze należy ją przepisać na kodującą.

3′ TACCGGGACACCTACGCGGAGGACGGGGACGACCGC… 5′

Mamy nić kodującą, możemy przepisać ją na mRNA (transkrypcja):

5’ AUGGCCCUGUGGAUGCGCCUCCUGCCCCUGCUGGCG… 3’.

Naszym pierwszym zadaniem jest podanie 4 aminokwasu, przyjmując, że w skład polipeptydu nie wchodzi aminokwas kodowany przez kodon start czyli AUG.

5’ AUG GCC CUG UGG AUG CGC CUC CUG CCC CUG CUG GCG … 3’.

Czwarty kodon to AUG czyli metionina.

Kolejnym zadaniem jest podanie aminokwasu w peptydzie 1, w którym doszło do delecji 4 nukleotydów.

DNA:    3′ TACCGGGACACCTACGCGGAGGACGGGGACGACCGC… 5′

mRNA: 5’ AUGGCCCUGUGGAUGCGCCUCCUGCCCCUGCUGGCG…3’

mRNA: 5’ AUG GCC CUG UGC GCC UCC UGC CCC UGC UGG CG… 3’

Aminokwas to alanina.

Podobne zadania:

  1. Maj 2014
  2. Czerwiec 2015
  3. Czerwiec 2017

Skomentuj

Wprowadź swoje dane lub kliknij jedną z tych ikon, aby się zalogować:

Logo WordPress.com

Komentujesz korzystając z konta WordPress.com. Wyloguj /  Zmień )

Zdjęcie na Google

Komentujesz korzystając z konta Google. Wyloguj /  Zmień )

Zdjęcie z Twittera

Komentujesz korzystając z konta Twitter. Wyloguj /  Zmień )

Zdjęcie na Facebooku

Komentujesz korzystając z konta Facebook. Wyloguj /  Zmień )

Połączenie z %s